View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3942_high_8 (Length: 243)
Name: NF3942_high_8
Description: NF3942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3942_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 8533865 - 8534092
Alignment:
| Q |
1 |
ttgaatgatattaatgttcactggagtctctccattgaaaatttcaccgaaagggatctacacccgtgtccaactaccaatatcatcatttgtcagctga |
100 |
Q |
| |
|
||||||| |||||||||||||| | |||||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8533865 |
ttgaatggtattaatgttcactacactctctccattgaaaattttaccgaaagagatctacactcgtgtccaactaccaatatcatcatttgtcagctga |
8533964 |
T |
 |
| Q |
101 |
gttaaaccagattaagaattaagttagttatataagttgactagaccatatgaagccgggtcgcatgtaaacaaagtagatatttgtttatatatattct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8533965 |
gttaaaccagattaagaattaagttagttatataagttgactacaccatatgaagccgggtcgcatgtaaacaaagtagatatttgtttatatatattct |
8534064 |
T |
 |
| Q |
201 |
acggaaaccataaaacggttacagaaac |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8534065 |
acggaaaccataaaacggttacagaaac |
8534092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University