View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3942_high_9 (Length: 235)
Name: NF3942_high_9
Description: NF3942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3942_high_9 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 33431510 - 33431298
Alignment:
| Q |
18 |
atgagtacacacatacttatttcaaagacaactcaggcatgttattattttatttatatcataaagtctaattcatatatatgtgttcttccatgcgtct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
33431510 |
atgagtacacacatacttatttcaaagacaacttaggcatgttattattt-atttatatcataaagtctaattcatatatatgtgtccttccatgcatct |
33431412 |
T |
|
| Q |
118 |
tggtgctggagaattaattaatccatcatccacacttaacagttttgacggcagaaacattgaaaattatggcgcgtgccactaattaagtgtgctttgt |
217 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
33431411 |
tggtgttggagaattaat----ccatcatccacacttaacagttttgagtgcagaaacattgaaagttatggcacgtgccactaattaagtgtgctttgt |
33431316 |
T |
|
| Q |
218 |
tcttgcagtggtcatcac |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33431315 |
tcttgcagtggtcatcac |
33431298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University