View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3942_low_11 (Length: 234)
Name: NF3942_low_11
Description: NF3942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3942_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 39362394 - 39362587
Alignment:
| Q |
1 |
agtcaaactctcgagttagaccatagaat-tatgacgagtcttgttattcattaatcatacttgattttctactttattccattggcatcactggcattt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39362394 |
agtcaaactctcgagttagaccatagaatatatgacgagtcttgttattcattaatcatacttgattttctactttattccattggcatcactggcattt |
39362493 |
T |
 |
| Q |
100 |
atcatgctgcttaaataaagcatgtgtgatttctcactggttgattttcttcttgtgttgtgacttgcaggaagaggagataaaccatatggca |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39362494 |
atcatgctgcttaaataaagcatgtgtgatttctcactggttgattttcttcttgtgttgtgacttgcaggaagaggagataaaccatatggca |
39362587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 189
Target Start/End: Original strand, 39364053 - 39364099
Alignment:
| Q |
143 |
attttcttcttgtgttgtgacttgcaggaagaggagataaaccatat |
189 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
39364053 |
attttcttattgtgttgtggcttgcaggaagaggagataaatcatat |
39364099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University