View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3943_high_41 (Length: 298)

Name: NF3943_high_41
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3943_high_41
NF3943_high_41
[»] chr3 (2 HSPs)
chr3 (48-177)||(55448373-55448503)
chr3 (201-298)||(55448224-55448321)


Alignment Details
Target: chr3 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 48 - 177
Target Start/End: Complemental strand, 55448503 - 55448373
Alignment:
48 caaacaatgaaggggggtttgttctttctttgctt-ccattccattcgatatcgggaaaccctaactagctagctaatcccatattattattattgctaa 146  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55448503 caaacaatgaaggggggtttgttctttctttgctttccattccattcgatatcgggaaaccctaactagctagctaatcccatattattattattgctaa 55448404  T
147 aacaaacacgattaatcaatcatgaagtatt 177  Q
    |||||||||||||||||||||||| ||||||    
55448403 aacaaacacgattaatcaatcatggagtatt 55448373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 201 - 298
Target Start/End: Complemental strand, 55448321 - 55448224
Alignment:
201 cctaactacctgagagatgtggagaacatgatgatatcaagcggcgtccggcgcgaatgagtgagtggatgaaggaaagatgtttattactatttact 298  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
55448321 cctaactacctgagagatgtggagaacatgatgatatcaagcggcgtccggcgcgaatgagcgagtggatgaaggaaagatgtttattactatttact 55448224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University