View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_high_41 (Length: 298)
Name: NF3943_high_41
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_high_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 48 - 177
Target Start/End: Complemental strand, 55448503 - 55448373
Alignment:
| Q |
48 |
caaacaatgaaggggggtttgttctttctttgctt-ccattccattcgatatcgggaaaccctaactagctagctaatcccatattattattattgctaa |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55448503 |
caaacaatgaaggggggtttgttctttctttgctttccattccattcgatatcgggaaaccctaactagctagctaatcccatattattattattgctaa |
55448404 |
T |
 |
| Q |
147 |
aacaaacacgattaatcaatcatgaagtatt |
177 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
55448403 |
aacaaacacgattaatcaatcatggagtatt |
55448373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 201 - 298
Target Start/End: Complemental strand, 55448321 - 55448224
Alignment:
| Q |
201 |
cctaactacctgagagatgtggagaacatgatgatatcaagcggcgtccggcgcgaatgagtgagtggatgaaggaaagatgtttattactatttact |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
55448321 |
cctaactacctgagagatgtggagaacatgatgatatcaagcggcgtccggcgcgaatgagcgagtggatgaaggaaagatgtttattactatttact |
55448224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University