View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_high_62 (Length: 242)
Name: NF3943_high_62
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_high_62 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 30809148 - 30809356
Alignment:
| Q |
18 |
catcaaaccatcttgtatactatgtcatcgaacactgcggcgcgcgtggcggtggtcttgttatggacgaaaaaataaggtgtttgctgattattcttca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30809148 |
catcaaaccatcttgtatactatgtcatcgaacgctgcggcgcgcatggcggtggtcttgttatggacgaaaaaataaggtgtttgctgattattcttca |
30809247 |
T |
 |
| Q |
118 |
ttttctgatagtgattcagatatcacttaagctaaggttacaactaatttacttatttttgtttctgaagacaaaattgatagagttttttcattacttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30809248 |
ttttctgatagtgattcagatatcacttaagctaaggttacaactaatttacttatttttatttctgaagacaaaattgat--agttttttcattacttg |
30809345 |
T |
 |
| Q |
218 |
ttaagtataat |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
30809346 |
ttaagtataat |
30809356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University