View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_low_23 (Length: 412)
Name: NF3943_low_23
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 18 - 399
Target Start/End: Complemental strand, 37341179 - 37340792
Alignment:
| Q |
18 |
cagatatggttgattgcgtgtggtcacgggattgtaattgcacataacccagatccatatagttcagctcaaggcggtcggtctaatattattgttgttt |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37341179 |
cagatatgattgattgcgtgtggtcacgggattgtaattgcacataacccagatccatatagttcagctcaaggcggtcggtctaatattattattgttg |
37341080 |
T |
|
| Q |
118 |
ttgtacttagcttggggggagatgaataaatggttgccatatgacatggatatagtttagccacaaggcgcaaagttaatatcagatctgcaagactaa- |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37341079 |
ttgtacttagcttggggggagatgaataaatggttgccatatgacatggatatagtttagccacaaggcgcaaagttaatatcagacctgcaagactaag |
37340980 |
T |
|
| Q |
217 |
-----agaaagggctaaaagaaagacaggaaacaagcatgaaagcacatggtatgttgtactagattgttttttgacatgtgaggctggttgacaatgct |
311 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37340979 |
actaaagaaagggctaaaagaaagacaggaaataagcatgaaagcacatggtatgttgtactagattgttttttgacatgtgaggctggttgacaatgct |
37340880 |
T |
|
| Q |
312 |
aatcatataattaataatccagttgaccaaaaatatatcattatttagccaattgtagttcacatttcacatacatagttggaccttc |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37340879 |
aatcatataattaataatccagttgaccaaaaaaatatcattatttagccaattgtagttcacatttcacatacatagttggaccttc |
37340792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University