View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_low_36 (Length: 326)
Name: NF3943_low_36
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 21 - 316
Target Start/End: Complemental strand, 29274964 - 29274669
Alignment:
| Q |
21 |
catgttcgaagtcctagggtgatgcaaccacatacaaccatccataaactgcacgccattggcttcacaagcttctaagatcaaatcaagctctgccaca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29274964 |
catgttcgaagtcctagggtgatgcaaccacatacaaccatccataaactgcacgccattggcctcacaagcttctaagatcaaatcaagctctgccaca |
29274865 |
T |
 |
| Q |
121 |
tcaagtgctgccggcttctccaccaacacatgcttcttcttattcgcggcagcaaccgcccacctcacgtgcagactagtcgggagaggaatgtacactg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
29274864 |
tcaagtgctgccggcttctccaccaacacatgcttcttcttattcgcagcagcaaccgcccacctcacgtgcagactcgttgggagaggaatgtacactg |
29274765 |
T |
 |
| Q |
221 |
catccacacctgaatcttccacaacctcatcatagctaccatagattcttacgctggctggtaaactgttttcgactgcaaattttgctgcctttg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29274764 |
catccacacctgaatcttccacaacctcatcatagctaccatagattcttacgctggctggtaaactgttttcgactgcaaattttgctgcctttg |
29274669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 34 - 95
Target Start/End: Complemental strand, 24579200 - 24579139
Alignment:
| Q |
34 |
ctagggtgatgcaaccacatacaaccatccataaactgcacgccattggcttcacaagcttc |
95 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||| | ||||||||||| |
|
|
| T |
24579200 |
ctagggtgatgcaaccacattgaaccatccataaactgcactccattagtctcacaagcttc |
24579139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University