View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_low_38 (Length: 315)
Name: NF3943_low_38
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 22 - 300
Target Start/End: Complemental strand, 42823045 - 42822767
Alignment:
| Q |
22 |
gcacagataaggcataagtcctctttaccaatatctatctaatttgggccattcattttgtattgcatttaatttgggtgtccaagatattctcatattc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42823045 |
gcacagataaggcataagtcctctttaccaatatctatctaatttgggccattcattttgtattgcatttaatttgggtgtccaagatattctcatattc |
42822946 |
T |
 |
| Q |
122 |
aatgaatagcagattttagttacgttactatttattatggtacatctttggagtgttttacactgcttcttttgaaagtgacaagaaatagatccaattt |
221 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42822945 |
aatgaatatcagattttagttacgttagtatttattatggtacatctttggagtgttttacactgcttcttttgaaagtgacaagaaatagatccaattt |
42822846 |
T |
 |
| Q |
222 |
taatttgtagaaatttgttatgaagaggccaatttgaagaccttaattttcatctcacaaggactgaaacagtttttac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
42822845 |
taatttgtagaaatttgttatgaagaggccaatttgaagaccttaattttaatctaacaaggactgaaacagtttttac |
42822767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University