View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_low_43 (Length: 295)
Name: NF3943_low_43
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_low_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 14 - 279
Target Start/End: Complemental strand, 7365543 - 7365278
Alignment:
| Q |
14 |
gagatgaacaaatatcattgtccatggtttttatggaacaagcccgccagcgcatttgagtcacggccacgacaaaaatacgattgcaatttagatcgta |
113 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7365543 |
gagatgaacaaatatcattgcccatggtttttatgaaacaaggccgccagcgcatttgagtcacggccacgacaaaaatacgattgcaatttagatcgta |
7365444 |
T |
 |
| Q |
114 |
tcagatctatatgaccgtgattctctacaatatcaagtatcagaatgcgaccacatttaatttataaaccttagttatatctatgtatctctatttccac |
213 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7365443 |
tcagatctatatgattgtgattctctacaatatcaagtatcagaacgtgaccacatgtaatttataaaccttagttatatctatgtatctctatttccac |
7365344 |
T |
 |
| Q |
214 |
aataattcttgaactgagccttgccaatgaagaacaagcatgagcataaccaaaaccgcagctaat |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7365343 |
aataattcttgaactgagccttgccaatgaagaacaagcatgagcataaccaaaaccgcagctaat |
7365278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University