View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_low_45 (Length: 284)
Name: NF3943_low_45
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_low_45 |
 | |
|
| [»] scaffold0361 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0361 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: scaffold0361
Description:
Target: scaffold0361; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 25 - 268
Target Start/End: Complemental strand, 12677 - 12434
Alignment:
| Q |
25 |
cttcaggccttagaaaaataacagtaacatgagataattcatatcccctagatttatcatctcatggtgatattgtttgagtgcaattcccctttttgca |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12677 |
cttcaggccttagaaaaataacagtaacatgagataattcatatcccctagatttatcatctcatggtgatattgtttgagtgcaattcccctttttgca |
12578 |
T |
|
| Q |
125 |
taatttcgatagattgaagnnnnnnnnnnnnngaatcacaagctcgtgatattgctactacgatgtgatggttagcacttagccgatacatattcactta |
224 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12577 |
taatttcgatagattgaagtttttttctttttgaatcacaagctcgtgatattgctactacgatgtgatggttagcacttagccgatacatattcactta |
12478 |
T |
|
| Q |
225 |
atgggacaggtgtttcttgctatgttgtttcaattctacttcat |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12477 |
atgggacaggtgtttcttgctatgttgtttcaattctacttcat |
12434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 173 - 267
Target Start/End: Complemental strand, 4947889 - 4947796
Alignment:
| Q |
173 |
atattgctactacgatgtgatggttagcacttagccgatacatattcacttaatgggacaggtgtttcttgctatgttgtttcaattctacttca |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4947889 |
atattgctactacgatgtgatggttagcacttagctgatac-tattcatataatgggacatgtgtttcttgctatgttgtttcaattctacttca |
4947796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 25 - 98
Target Start/End: Complemental strand, 4948019 - 4947946
Alignment:
| Q |
25 |
cttcaggccttagaaaaataacagtaacatgagataattcatatcccctagatttatcatctcatggtgatatt |
98 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4948019 |
cttcaggccttagaacaataacagtaacatgagataattcatatcccctagatatatcatctcatggtgatatt |
4947946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University