View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_low_47 (Length: 277)
Name: NF3943_low_47
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_low_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 110 - 244
Target Start/End: Complemental strand, 3429837 - 3429702
Alignment:
| Q |
110 |
acacatcgattggggg-ttttgcttggttccacgtggagtttgatagatttctttcatttaaggcaatggatattagagattgcgtgaaacagaaaaaga |
208 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429837 |
acacatcgattggggggttttgcttggttccacgtggagtttgatagatttctttcatttaaggcaatggatattagagattgcgtgaaacagaaaaaga |
3429738 |
T |
 |
| Q |
209 |
aaaagatgtttggtataaattaactgactttgtttc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429737 |
aaaagatgtttggtataaattaactgactttgtttc |
3429702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 14 - 48
Target Start/End: Complemental strand, 3429929 - 3429895
Alignment:
| Q |
14 |
agactctctaacattgagtttcttaatttacagag |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429929 |
agactctctaacattgagtttcttaatttacagag |
3429895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University