View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_low_50 (Length: 273)
Name: NF3943_low_50
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 102 - 258
Target Start/End: Original strand, 21269628 - 21269784
Alignment:
| Q |
102 |
ggggtggagatagtaataacaatgaaggaggaggtgaagttaagataatggagtatatggttcaacaacccttcggttttggttatggaaatgtaaatgt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21269628 |
ggggtggagatagtaataacaatgaaggaggaggtgaagttcagataatggagtatatggttcaacaaccctttggttttggttatggaaatgtaaatgt |
21269727 |
T |
|
| Q |
202 |
tgaggggtataatgctgcacaagtttaccaagagatgttaaatattcatatgcaaac |
258 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21269728 |
tgaagggtataatgctgcacaagtttaccaagagatgttaaatattcatatgcaaac |
21269784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 21269527 - 21269561
Alignment:
| Q |
1 |
gagaaaggttgaggtagttcaaccaaagaaagaca |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
21269527 |
gagaaaggttgaggtagttcaaccaaagaaagaca |
21269561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University