View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_low_53 (Length: 266)
Name: NF3943_low_53
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 64 - 141
Target Start/End: Original strand, 22334720 - 22334797
Alignment:
| Q |
64 |
gaatggtgattttataattggtttgtggtggtcggagttaattaaatcttagagagaagtcggttggtgttgtttgat |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22334720 |
gaatggtgattttataattggtttgtggtggtcggagttaattaaatcttagagagaagtcggttggtgttgtttgat |
22334797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 29 - 67
Target Start/End: Original strand, 22326502 - 22326540
Alignment:
| Q |
29 |
ccgccgtgctgctgtaagggagattggaaggataagaat |
67 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22326502 |
ccgccgtgatgctgtaagggagattggaaggataagaat |
22326540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University