View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_low_57 (Length: 264)
Name: NF3943_low_57
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_low_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 14 - 247
Target Start/End: Complemental strand, 55245138 - 55244903
Alignment:
| Q |
14 |
tactggtcctttcttttggtcaagtgaaacgaaacgagggtttcattactttttctgcttacca-tatttcatttcattgataaattcatctgatctcaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||| |||||||||||| ||||||| |
|
|
| T |
55245138 |
tactggtcctttcttttggtcaagtgaaacgaaacgagggtttcattactttttctgcttgggactaccatatttcattcataaattcatctcatctcaa |
55245039 |
T |
 |
| Q |
113 |
ccttcacctttttctcttactt-gtttacatcaccttcagctatatatcacatcaatcatcttgtgctttggcttttcgactccaattttattattaatt |
211 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
55245038 |
ccttcacctttttctcttactttgtttacatcaccttcagctatatatgacatcaatcatcttgtgctttggcttttcgactccaattttatgtttaatt |
55244939 |
T |
 |
| Q |
212 |
tctcagttgcaggcaatgtttgttgtactatttatt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
55244938 |
tctcagttgcaggcaatgtttgttgtactatttatt |
55244903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University