View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_low_58 (Length: 256)
Name: NF3943_low_58
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_low_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 2 - 243
Target Start/End: Original strand, 43128672 - 43128911
Alignment:
| Q |
2 |
ctatatgcatatataatactacgtagctagtatgcatcacatcaaagtatatagatagattctttgcagcccctcacatcctcttcaacacaatcttagt |
101 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43128672 |
ctatatgcatatata---ctacgtagctagtatgcatcacatcaaagtatatagatagattctttgcagcccctcatatcctcttcaacacaatcttagt |
43128768 |
T |
|
| Q |
102 |
tgttgaactaatataactatcacgaagtaaattatacctagaagacatgtagacaacaaattgctctgttaggtcttttggatgaaagtttttactatgc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||| ||| |
|
|
| T |
43128769 |
tgttgaactaatataactatcacgaagtaaattatacctagaagacatgtagacaacaaattgtgcttttaggtctttttgatgaaagtttttacgatgt |
43128868 |
T |
|
| Q |
202 |
t-tagtgaaagtttaattgttttcactaaccaattttcctttg |
243 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43128869 |
tgtagtgaaagtttaattgttttcactaaccaattctcctttg |
43128911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University