View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_low_59 (Length: 251)
Name: NF3943_low_59
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_low_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 59 - 236
Target Start/End: Original strand, 4475495 - 4475672
Alignment:
| Q |
59 |
aaattgttgaaacagcaataattactgaaaattgatacacatagataaaagagatgaggttcaaaacttaatcaaaattttaatctaataattttaatat |
158 |
Q |
| |
|
||||||| |||||| |||||| || | |||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
4475495 |
aaattgtcgaaacaacaataactattaaaaattgatacacataaataaaagagatgaggttaaaaccttaatcaaaattttaatctaataattttaacat |
4475594 |
T |
 |
| Q |
159 |
tttcgtcagttgaacatatacttacgaactaaaaggaaattgaattttataataacaaaaaggaagatgtacaatatt |
236 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4475595 |
tttcgtcagtccaacatatacttacgaactaaaaagaaattgaattttataataacaaaaatgaagatgtacaatatt |
4475672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University