View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_low_63 (Length: 245)
Name: NF3943_low_63
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_low_63 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 245
Target Start/End: Original strand, 43128426 - 43128654
Alignment:
| Q |
17 |
agttagttgagtggaattaatgaaatgctagctggagctacttgtacaatttctaaagggttaaacaagaatctatatatctatgctttaacttagcttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43128426 |
agttagttgagtggaattaatgaaatgctagctggagctacttgtacaatttctaaagggttaaacaagaatctatatatctatgctttaacttggcttt |
43128525 |
T |
 |
| Q |
117 |
tttcacatggttgttcgattttttggaatctttagatgctattgttgcatcttaaattagaaaaagcatattatgctatgctagtaaaagattcataagt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43128526 |
tttcacatggttgttcgattttttggaatctttagatgctattgttgcatcttaaattagaaaaagcatattatgctatgctactaaaagattcataagt |
43128625 |
T |
 |
| Q |
217 |
atctaattatagctgtataagaatttatt |
245 |
Q |
| |
|
||||||||||||||||| ||||||||||| |
|
|
| T |
43128626 |
atctaattatagctgtacaagaatttatt |
43128654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University