View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_low_70 (Length: 236)
Name: NF3943_low_70
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_low_70 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 34946602 - 34946378
Alignment:
| Q |
1 |
tcaacatattcggataaaattgacactaagaagagttaaactagagatatcgaaagac----attctaaagtctcacgtctacattttcagactaatcca |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34946602 |
tcaacatattcggataaaattgacactaagaagagttaaactagagatatcgaaagacgtacattctaaagtctcacgtctacattttcagactaatcca |
34946503 |
T |
 |
| Q |
97 |
agtgaattgacaaaaatgtatcattgttgaaaacataatactatacaatttcatcattgttgctaagagccacttgccataaacagacagtagacaccaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34946502 |
agtgaattgacaaaaatgtatcattgttgaaaacataatactatacaatttcatcattgttactaagagccacttgccataaacagacagtagacaccaa |
34946403 |
T |
 |
| Q |
197 |
ccataagtagttcacgagttgagac |
221 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
34946402 |
ccataattagttcacgagttgagac |
34946378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University