View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3943_low_78 (Length: 204)
Name: NF3943_low_78
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3943_low_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 39378473 - 39378302
Alignment:
| Q |
15 |
gagatgaaacagagtggtttgagaaaaggaactattataggaattgttattggtgatttcgttggaattggaatcttagctatggtttttgtttatgttt |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39378473 |
gagaagaaacagagtggtttgagaaaaggaactattataggaattgttattggtgatttcgttggaattggaatcttagctatggtttttgtttatgttt |
39378374 |
T |
 |
| Q |
115 |
ataagctaaagagnnnnnnngatgcggaaaatgcaataaaaaatgaagctgctactacaagaagtgagaatt |
186 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
39378373 |
ataagctaaagagaaaaaaagatgcggaaaatgcaataaaaaatgaagttgctactgcaagaagtgagaatt |
39378302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University