View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3943_low_78 (Length: 204)

Name: NF3943_low_78
Description: NF3943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3943_low_78
NF3943_low_78
[»] chr4 (1 HSPs)
chr4 (15-186)||(39378302-39378473)


Alignment Details
Target: chr4 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 39378473 - 39378302
Alignment:
15 gagatgaaacagagtggtttgagaaaaggaactattataggaattgttattggtgatttcgttggaattggaatcttagctatggtttttgtttatgttt 114  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39378473 gagaagaaacagagtggtttgagaaaaggaactattataggaattgttattggtgatttcgttggaattggaatcttagctatggtttttgtttatgttt 39378374  T
115 ataagctaaagagnnnnnnngatgcggaaaatgcaataaaaaatgaagctgctactacaagaagtgagaatt 186  Q
    |||||||||||||       |||||||||||||||||||||||||||| ||||||| |||||||||||||||    
39378373 ataagctaaagagaaaaaaagatgcggaaaatgcaataaaaaatgaagttgctactgcaagaagtgagaatt 39378302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University