View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3944_high_3 (Length: 325)
Name: NF3944_high_3
Description: NF3944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3944_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 32822635 - 32822329
Alignment:
| Q |
1 |
atttcactcaagctggctaaagaagcaatctcccgtctgtaaaatcgaccgcatccttaaagtccagaacacacagaaaaccataaccaagttcgaagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32822635 |
atttcactcaagctggctaaagaagcaatctcccgtctgtaaaatcgaccgcatccttaaagtccagaacacacagaaaaccataaccaagttcgaagag |
32822536 |
T |
 |
| Q |
101 |
tacagagactcaatcaaagcaaaagcaacaaatctctcnnnnnnncatccccgctgcatagcagacggaaacgagttactaaggtttcactgcacaagct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32822535 |
tacagagactcaatcaaagcaaaagcaacaaatctctcaaaaaaacatccccgctgcatagcagacggaaacgagttactaaggtttcactgcacaacct |
32822436 |
T |
 |
| Q |
201 |
ttgtttgttctttaggcctaaacggttcctcaaatctctgcaactcaacatcacaatgcaatgtatgcggcataataaaacacgggtttaagttgaatgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32822435 |
ttgtttgttctttaggcctaaacggttcctcaaatctctgcaactcaacatcacaatgcaatgtgtgcggcataataaaacacgggtttaagttgaatgg |
32822336 |
T |
 |
| Q |
301 |
tggcgat |
307 |
Q |
| |
|
||||||| |
|
|
| T |
32822335 |
tggcgat |
32822329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University