View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3944_low_4 (Length: 281)
Name: NF3944_low_4
Description: NF3944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3944_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 121 - 258
Target Start/End: Original strand, 25678479 - 25678611
Alignment:
| Q |
121 |
taaacagaatcttacgttgacatcaaagtctctttgcatgtaccttttactcattgaaataacaataggggatctatcaacaaagaaggattcatcacat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
25678479 |
taaacagaatcttacgttgacatcaaagtctctttgcatgtaccttttactcattgaaataacaataggggatctatcaacaaagaaggattcatcgc-- |
25678576 |
T |
|
| Q |
221 |
caccatctaagtgatagatagtcaccatattgcatcca |
258 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
25678577 |
---catctaagtgatagatagtcaccatatttcatcca |
25678611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 123
Target Start/End: Original strand, 25677914 - 25678019
Alignment:
| Q |
19 |
ctctccttaaaaataatcacttcttactaccctcagaagattcttatccac-ttatataagttagaaacataatgaactnnnnnnnttgaagttttctcc |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25677914 |
ctctccttaaagataatcacttcttactaccctcagaagattcttatccactttatataagttagaaacataatgaactaaaaaaattgaagttttctcc |
25678013 |
T |
|
| Q |
118 |
acataa |
123 |
Q |
| |
|
|||||| |
|
|
| T |
25678014 |
acataa |
25678019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University