View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3944_low_5 (Length: 255)
Name: NF3944_low_5
Description: NF3944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3944_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 245
Target Start/End: Complemental strand, 47754751 - 47754525
Alignment:
| Q |
19 |
attaataccaacaaggtcttgtaatgacatagagaaatcagaagtcttgtaacttccatcagaattcacaatgattttttgatcacaactatttgattgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47754751 |
attaataccaacaaggtcttgtaatgacatagagtaatcagaattcttgtaacttccatcagaattcacaatgattttttgatcacaactatttgattgc |
47754652 |
T |
|
| Q |
119 |
tgttgctgcaaaaccatcttccattttgaatcattattttcgttgtccttttgcgcttcagcggcttctccattggtctggctcgatacattagtactat |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47754651 |
tgttgttgcaaaaccatcttccattttgaatcattattttcgttgtccttttgcgcttcagcggcttctccattggtctggctcgatacattagtactat |
47754552 |
T |
|
| Q |
219 |
gattatattcatgaacttcggtctgtg |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
47754551 |
gattatattcatgaacttcggtctgtg |
47754525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University