View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3945_high_9 (Length: 302)
Name: NF3945_high_9
Description: NF3945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3945_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 17 - 293
Target Start/End: Original strand, 6240108 - 6240384
Alignment:
| Q |
17 |
cattcatcatatcttggagcttttggagtctatccttgaagattgaagcctaggagagttgatgcttagtgaggatgcaaagagattcgttgtgtcgttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6240108 |
cattcatcatatcttggagcttttggagtctatccttgaagattgaagcctaggagagttgatgcttagtgaggatgcaaagagattcgttgtgtcgttt |
6240207 |
T |
 |
| Q |
117 |
tatctttaaaatgactcttttgacgatgaatatcattccattttatttcttaagcttaccatgagctaacccatttcgtgtttaagggttaatgaaatta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6240208 |
tatctttaaaatgactcttttgacgatgaatatcattccattttatttcttaagcttaccatgagctaacccatttcgtgtttaagggttaatgaaatta |
6240307 |
T |
 |
| Q |
217 |
taagttgatgtttggatgttagtatgttgtaatatgtttgcnnnnnnnnaaattacttgtcttaactctaacctttg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6240308 |
taagttgatgtttggatgttagtatgttgtaatatgtttgcttttttttaaattacttgtcttaactctaacctttg |
6240384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University