View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3945_low_11 (Length: 294)
Name: NF3945_low_11
Description: NF3945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3945_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 18 - 284
Target Start/End: Original strand, 37467082 - 37467348
Alignment:
| Q |
18 |
atagggatacgcttttgttgtgcttccggttttggtatgccatttctcaactctaaggtgctctgtttgaaaaatggttgtggtttgtaatgttctgtta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37467082 |
atagggatacgcttttgttgtgcttccggttttggtatgccatttctcaactctaaggtgctctgtttgaaaaatggttatggtttgtaatgttctgtta |
37467181 |
T |
|
| Q |
118 |
tagctaccatatttatagtttattattaaacatgtgattaattactaaagaaggaggctatagttattcgataacgatatgaatgaatctattgcctcaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37467182 |
tagctaccatatttatagtttattattaaacatgtcattaattactaaagaaggaggctatagttattcgataacgatatgaatgaatctattgcctcaa |
37467281 |
T |
|
| Q |
218 |
caattcaaccaatgcaacttttattcgttcaaaggcaggccaagggcttatcaaattcgattctctg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37467282 |
caattcaaccaatgcaacttttattcgttcaaaggcaggccaagggcttatcaaattcgattctctg |
37467348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 32 - 99
Target Start/End: Original strand, 37469420 - 37469487
Alignment:
| Q |
32 |
ttgttgtgcttccggttttggtatgccatttctcaactctaaggtgctctgtttgaaaaatggttgtg |
99 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||| |||||| ||| |||||||| |
|
|
| T |
37469420 |
ttgttgtggtttcggttttggtatgccatttctcaactctaaggtgcactgttttaaagttggttgtg |
37469487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 32 - 103
Target Start/End: Original strand, 37464484 - 37464559
Alignment:
| Q |
32 |
ttgttgtgcttccggttttggtatgccatttctc-aactc---taaggtgctctgtttgaaaaatggttgtggttt |
103 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||| ||||||| |||||| ||||| || ||||||||| |
|
|
| T |
37464484 |
ttgttgtgcttcctgttttggtatgccatttctcaaactctagtaaggtggtctgttggaaaattgattgtggttt |
37464559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University