View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3945_low_7 (Length: 345)
Name: NF3945_low_7
Description: NF3945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3945_low_7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 10 - 345
Target Start/End: Original strand, 14293564 - 14293899
Alignment:
| Q |
10 |
catcatcatcacttgttccat-tttagcatgatcaccttgagcatttgctctgaccctctctggataaaatggcatgtccacaggccactggacataggc |
108 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14293564 |
catcatcatcacttgttccagctttagcatgatcaccttgagcatttgctctgaccctctctggataaaatggcatgtccacaggccactggacataggc |
14293663 |
T |
|
| Q |
109 |
attgtagaaatccaggttgatcactggaaagtctctagttcctggattttgcatttgtatcagcaacctgtacatatagccattcaaactagtaagggat |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14293664 |
attgtaggaatccaggttgatcactggaaagtctctggttcctggattttgcatttgtatcagcaacctgtacatatagccattcaaactagtaagggat |
14293763 |
T |
|
| Q |
209 |
ctattctgggtatcgactatatcccagctatgtgtaaatgatgctctaatacgtggatcccttctaccagaatgaggttttcttcaggtccnnnnnnnnn |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
14293764 |
ctattctgggtatcgactatatcccagctatgtgtaaatgatgctctaatacgtggatcccttctaccagaatgagattttctttaggtcc-ttttttta |
14293862 |
T |
|
| Q |
309 |
aaaccgtgtttggttgaatttatgttttctgcattct |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14293863 |
aaaccgtgtttggttgaatttatgttttctgcattct |
14293899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University