View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3946_high_8 (Length: 247)
Name: NF3946_high_8
Description: NF3946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3946_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 3181483 - 3181721
Alignment:
| Q |
1 |
tctttgatgattccttatagtcaacagggaatattcgtgagtggcactgttaattggttggcggattatgatttggatgataataatagcttgggtacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3181483 |
tctttgatgattccttatagtcaacagggaatattcgtgagtggcactgttaattggttggcggattatgatttggatgataataatagcttgggtacta |
3181582 |
T |
 |
| Q |
101 |
ttgtttctcttgatttgcggaaagaaatttatcaagagatttcacagcctgattatggtgatgtaaccgttaagttgagtttgggtgcgatgagggaatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3181583 |
ttgtttctcttgatttgcggaaagaaatttatcaagagatttcacagcctgattatggtgatgtaaccgttaagttgagtttgggtgcgatgagggaatg |
3181682 |
T |
 |
| Q |
201 |
tttgtgtgtattttctcattccgactcttttgatgatgt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3181683 |
tttgtgtgtattttctcattccgactcttttgatgatgt |
3181721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 100 - 158
Target Start/End: Complemental strand, 24243040 - 24242982
Alignment:
| Q |
100 |
attgtttctcttgatttgcggaaagaaatttatcaagagatttcacagcctgattatgg |
158 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
24243040 |
attgtttctcttgatttggggaaagaatcttaccaagatatttcacagcctgattatgg |
24242982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 100 - 158
Target Start/End: Original strand, 25478733 - 25478791
Alignment:
| Q |
100 |
attgtttctcttgatttgcggaaagaaatttatcaagagatttcacagcctgattatgg |
158 |
Q |
| |
|
|||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25478733 |
attgtttctcttcatttggggaaagagtcttatcaagagatttcacagcctgattatgg |
25478791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 62
Target Start/End: Complemental strand, 9562218 - 9562182
Alignment:
| Q |
26 |
agggaatattcgtgagtggcactgttaattggttggc |
62 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
9562218 |
agggagtatttgtgagtggcactgttaattggttggc |
9562182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University