View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3946_low_13 (Length: 238)
Name: NF3946_low_13
Description: NF3946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3946_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 9 - 216
Target Start/End: Complemental strand, 34426590 - 34426383
Alignment:
| Q |
9 |
gttgctttgaatttgaggtactattttgtttcattgttatgcagtcttctataaacagtgaggtggatgaaattttgtctgtttattgtttgtgggatat |
108 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34426590 |
gttgctttgaatttgaggtcctattttgtttcattgttatgcagtcttctataaacagtgaggtggatgaaattttgtctgtttattgtttgtgggatat |
34426491 |
T |
 |
| Q |
109 |
atttgattcttttagtgtctgccaatccatgtcttattttaatgaatgcgctcacttgttatggagttgcttaactcactttctgtcgtttattgggtaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34426490 |
atttgattcttttagtgtctgccaatccatgtcttattttaatgaatgcgctcacttgttatggagttgcttaactcactttctgtcgtttattgggtaa |
34426391 |
T |
 |
| Q |
209 |
cagatccc |
216 |
Q |
| |
|
|||||||| |
|
|
| T |
34426390 |
cagatccc |
34426383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University