View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3946_low_14 (Length: 212)
Name: NF3946_low_14
Description: NF3946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3946_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 203
Target Start/End: Complemental strand, 10769718 - 10769527
Alignment:
| Q |
12 |
agtttgtatttatatatagttgtttccaattgcctgtaagcatgtataatggttttcaggcgagaagagcgttgcgcgccttgagaggtttggtgagatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10769718 |
agtttgtatttatatatagttgtttccaattgcctgtaagcatgtataatggttttcaggcgagaagagcgttgcgcgccttgagaggtttggtgagatt |
10769619 |
T |
 |
| Q |
112 |
gaagacaatggttcaaggacaatctgtaaaacggcaagctgacagcaccttaagatgcatgcaaactctagcaagattgcagtcacaggttc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10769618 |
gaagacaatggttcaaggacaatctgtaaaacggcaagctgacagcaccttaagatgcatgcaaactctagcaagattgcagtcacaggttc |
10769527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University