View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3946_low_3 (Length: 349)
Name: NF3946_low_3
Description: NF3946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3946_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 18 - 337
Target Start/End: Complemental strand, 39291467 - 39291149
Alignment:
| Q |
18 |
actggtgcccctaaatgttacttttcaaatgatttttgaaattgaccttttagatcagaataaatataagaaacgaaacgtattcgagcaaaccaagcag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39291467 |
actggtgcccctaaatgttacttttcaaatgatttttgaaattgaccttttagatcagaataaatataagaaacgaaacgtattcgagcaaaccaagaag |
39291368 |
T |
 |
| Q |
118 |
ttattgttaacttcgtaaagatttgaaacgttttggattatgttatgattacgtttatcctctgtaactactccgaatggtaccaatgcgcgtatcaaag |
217 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39291367 |
ttattgttaacttcgcaaagatttgaaacgttt-ggattatgttatgattacgtttatcctctgtaactacttcgaatggtaccaatgcgcgtatcaaag |
39291269 |
T |
 |
| Q |
218 |
caattgcaccccttccaaggtttactccctctgcgcaatgtgtccataatgacagttcgttttttagttatctatgtttataattatgactatctcgcat |
317 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39291268 |
cgattgcaccccttccaaggtttactccctctgcgcaatgtgtccataatgacagttcgttttttagttatctatgtttataattatgactatctcgcat |
39291169 |
T |
 |
| Q |
318 |
atatttgaagtttcttcctt |
337 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39291168 |
atatttgaagtttcttcctt |
39291149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University