View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3946_low_4 (Length: 313)
Name: NF3946_low_4
Description: NF3946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3946_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 162 - 297
Target Start/End: Original strand, 37322957 - 37323092
Alignment:
| Q |
162 |
tctctctctttttctcaagaaaatgcaaagcaatggggctttccaaattgaaagcatatcacacgctctctccctgcagatttgcttcctatattaatga |
261 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37322957 |
tctctctctctttctcaagaaaatgcaaagcaatggggctttccaaattgaaagcatatcacacgctctctccctgcagatttgcttcccatattaatga |
37323056 |
T |
|
| Q |
262 |
ctctgtctcacgcaagctggctctgctacgcctaac |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37323057 |
ctctgtctcacgcaagctggctctgctacgcctaac |
37323092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 42 - 170
Target Start/End: Original strand, 37322803 - 37322923
Alignment:
| Q |
42 |
aatgaattttgtaagtgaaaaatttagagtagatgaatggtagtagtgtactactacaagttctccctagctatcgggccacacatattgattactccta |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37322803 |
aatgaattttgtaagtgaaaaatttagagtagatgaatg---gtagtgtactactacaagttctccctagctatcgggccacacat-----ttactccta |
37322894 |
T |
|
| Q |
142 |
taagattcacattcattctttctctctct |
170 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
37322895 |
taagattcacattcattctctctctctct |
37322923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University