View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3946_low_8 (Length: 250)
Name: NF3946_low_8
Description: NF3946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3946_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 50 - 202
Target Start/End: Complemental strand, 40256744 - 40256592
Alignment:
| Q |
50 |
tcccaccaatcattgaactactgctacttctacaacaacgggtccaccaaccatacacgatccaattgtggaagaaattcaaccaaattattcccaaaaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40256744 |
tcccaccaatcattgaactactgctacttctacaacaacgggtccaccaaccatacacgatccaattgtggaagaaattcaaccaaattattcccaaaaa |
40256645 |
T |
 |
| Q |
150 |
caaactcaataaacaacgtaaatgaacaagaatcatattaattaataatgata |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40256644 |
caaactcaataaacaacgtaaatgaacaagaatcatattaattaataatgata |
40256592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University