View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3947_high_5 (Length: 262)
Name: NF3947_high_5
Description: NF3947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3947_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 181 - 259
Target Start/End: Original strand, 50247709 - 50247787
Alignment:
| Q |
181 |
gtgtgaaggatgttttatatagtcaatagacattatactttattgacttgaggccgacaaacattacctatgctactcc |
259 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
50247709 |
gtgtgtaggatgttttatatagtcactagacattatactttattgacttgaggccgacaaacattacttatgcttctcc |
50247787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 195 - 231
Target Start/End: Complemental strand, 50247673 - 50247637
Alignment:
| Q |
195 |
ttatatagtcaatagacattatactttattgacttga |
231 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50247673 |
ttatatagtcactagacattatactttattgacttga |
50247637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 109
Target Start/End: Complemental strand, 21546088 - 21546021
Alignment:
| Q |
43 |
ggagaagcagccacaaataagtatgggtgttattttt-ggttgattagaacatgattaaatgaatatt |
109 |
Q |
| |
|
||||||| ||||||||||| ||||| || ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
21546088 |
ggagaagtagccacaaatatgtatgagtactattttttggttgattataacatgattaaatgaatatt |
21546021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 230
Target Start/End: Original strand, 7498691 - 7498763
Alignment:
| Q |
158 |
gaggcttattttaattttgcttcgtgtgaaggatgttttatatagtcaatagacattatactttattgacttg |
230 |
Q |
| |
|
||||||||||| ||||| || ||||| ||||||||||||| || |||||||| |||| ||||||||||||| |
|
|
| T |
7498691 |
gaggcttatttagattttactatgtgtgtaggatgttttataaagccaatagaccttatgctttattgacttg |
7498763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 56 - 106
Target Start/End: Original strand, 46885285 - 46885336
Alignment:
| Q |
56 |
caaataagtatgggtgttatttt-tggttgattagaacatgattaaatgaat |
106 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
46885285 |
caaataagtatgggtattattttttggttgattataacatgattaaatgaat |
46885336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University