View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3947_low_7 (Length: 262)

Name: NF3947_low_7
Description: NF3947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3947_low_7
NF3947_low_7
[»] chr3 (2 HSPs)
chr3 (181-259)||(50247709-50247787)
chr3 (195-231)||(50247637-50247673)
[»] chr8 (2 HSPs)
chr8 (43-109)||(21546021-21546088)
chr8 (158-230)||(7498691-7498763)
[»] chr4 (1 HSPs)
chr4 (56-106)||(46885285-46885336)


Alignment Details
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 181 - 259
Target Start/End: Original strand, 50247709 - 50247787
Alignment:
181 gtgtgaaggatgttttatatagtcaatagacattatactttattgacttgaggccgacaaacattacctatgctactcc 259  Q
    ||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| ||||    
50247709 gtgtgtaggatgttttatatagtcactagacattatactttattgacttgaggccgacaaacattacttatgcttctcc 50247787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 195 - 231
Target Start/End: Complemental strand, 50247673 - 50247637
Alignment:
195 ttatatagtcaatagacattatactttattgacttga 231  Q
    ||||||||||| |||||||||||||||||||||||||    
50247673 ttatatagtcactagacattatactttattgacttga 50247637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 109
Target Start/End: Complemental strand, 21546088 - 21546021
Alignment:
43 ggagaagcagccacaaataagtatgggtgttattttt-ggttgattagaacatgattaaatgaatatt 109  Q
    ||||||| ||||||||||| ||||| ||  ||||||| ||||||||| ||||||||||||||||||||    
21546088 ggagaagtagccacaaatatgtatgagtactattttttggttgattataacatgattaaatgaatatt 21546021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 230
Target Start/End: Original strand, 7498691 - 7498763
Alignment:
158 gaggcttattttaattttgcttcgtgtgaaggatgttttatatagtcaatagacattatactttattgacttg 230  Q
    |||||||||||  ||||| ||  ||||| ||||||||||||| || |||||||| |||| |||||||||||||    
7498691 gaggcttatttagattttactatgtgtgtaggatgttttataaagccaatagaccttatgctttattgacttg 7498763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 56 - 106
Target Start/End: Original strand, 46885285 - 46885336
Alignment:
56 caaataagtatgggtgttatttt-tggttgattagaacatgattaaatgaat 106  Q
    ||||||||||||||| ||||||| |||||||||| |||||||||||||||||    
46885285 caaataagtatgggtattattttttggttgattataacatgattaaatgaat 46885336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University