View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3948_high_7 (Length: 297)
Name: NF3948_high_7
Description: NF3948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3948_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 9 - 290
Target Start/End: Original strand, 25658487 - 25658768
Alignment:
| Q |
9 |
atataataacttatgatttgtttttctctgtcacaacatatgtgacactcaatatagtagtagattatattatagagtttttctatgagttgtgaacttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25658487 |
atataataacttatgatttgtttttctctgtcacaacatatgtgacactcaatatagtagtagattatattatagagtttttctatgagttgtgaacttc |
25658586 |
T |
 |
| Q |
109 |
ttctgaactttgagaggttgaagcatctaggtaattgccctaatcagacacttattccttgggttgggggagttgttcggtcgtctttttgttctataat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25658587 |
ttctgaactttgagaggttgaagcatctaggtaattgccctaatcagacacttattccttgggttgggggagttgttcggtcgtctttttgttctataat |
25658686 |
T |
 |
| Q |
209 |
aaattactatgttgttttactatgttttataaattttggtttcttgctagggctacatatgctcttttgttagcctatgctt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25658687 |
aaattactatgttgttttactatgttttataaattttggtttcttgctagggctacatatgctcttttgttagcctatgctt |
25658768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University