View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3948_low_12 (Length: 244)
Name: NF3948_low_12
Description: NF3948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3948_low_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 38 - 244
Target Start/End: Original strand, 25658302 - 25658497
Alignment:
| Q |
38 |
tttatttttcactacatctttagagggttgaactgctttttatttttcaagtacttaattgacagtaacactaacatgcatgatttctcatactcataag |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
25658302 |
tttatttttcactacatctttagagggttgaattgctttttatttttcaagtaattaattgacaggaacact------------ttctcatactcataag |
25658389 |
T |
 |
| Q |
138 |
acttctttt-ttacttattaaaaaataatcacaaattgtgacctatttgatatgatatattggattacaccaacagttcaaatattggcatgtattaata |
236 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25658390 |
acttctttttttacttattaaaaaataatcacaaattgtgacctatttgatatgatatattggattacaccaacagttcaaatattggcatgtattaata |
25658489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University