View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3948_low_13 (Length: 241)
Name: NF3948_low_13
Description: NF3948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3948_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 33637175 - 33636957
Alignment:
| Q |
1 |
ttattttaagatatgcattgtcagatattagatgtgttgaatatattagaaaggcttttcggcatctttatacagtaggttcaattagttttttggtcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33637175 |
ttattttaagatatgcattgtcagatattagatgtgttgaatatattagaaaggctttacggcatctttatacagtaggttcagttagttttttggtcat |
33637076 |
T |
 |
| Q |
101 |
catggcaaaaaggatgacttctttacctgcttttccctttaacgcagaagtttataatctagaaccgtggataaaaaacgacaggtacaaccaagcatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33637075 |
catggcaaaaaggatgacttctttacctgctttaccctttaatgcagatgtttataatctagaaccgtggataaaaaacgacaggtacaaccaagcatat |
33636976 |
T |
 |
| Q |
201 |
aaagaagtgcacatttaat |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33636975 |
aaagaagtgcacatttaat |
33636957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University