View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3948_low_9 (Length: 267)
Name: NF3948_low_9
Description: NF3948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3948_low_9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 13 - 267
Target Start/End: Complemental strand, 35076744 - 35076502
Alignment:
| Q |
13 |
cacagacacacgtgtgagctgctacaaaattatggtacggctgataaggaaacattattactgaaaaagtacatcatgaccatgacactt-atgaaattc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35076744 |
cacagacacacgtgtgagctgctacaaaattatggtacggatgataaggaaacattattattgaaaaagtacatcatgaccatgacactttatgaaattc |
35076645 |
T |
|
| Q |
112 |
cacactgctatatactattactagtttagtttacttcaaattttgtatatcgatctagcttgcgacaaatatcttcttctcaaataaaatactatgcatc |
211 |
Q |
| |
|
|| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35076644 |
ca-------------tattactaatttagtttacttcaaattttgtatatcgatctagcttgcgacaaatatcttcttctcaaataaaatactatgcatc |
35076558 |
T |
|
| Q |
212 |
tgcgcacgttctcatgaaaatcagaagccactagtaataaagtaaacacgaattca |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35076557 |
tgcgcacgttctcatgaaaatcagaagccactagtaataaaataaacacgaattca |
35076502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University