View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3949_high_17 (Length: 373)
Name: NF3949_high_17
Description: NF3949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3949_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 18 - 360
Target Start/End: Complemental strand, 45066420 - 45066078
Alignment:
| Q |
18 |
catgccttatactcgaccccatcaatatatactgatgcaaaacacgctgcaaatgaagcctggccaatcaagaccgatgactactttccgtgagttctaa |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45066420 |
catgccttatactcaaccccatcaatatatactgatgcaaaacacgctgcaaatgaagcctggccaatcaagaccgatgactactttccgtgagttctaa |
45066321 |
T |
 |
| Q |
118 |
aagcaaaatgtgtaatatattcaggaagaagcttcagattgtagattatgccggcaacatgactttgagaataacattagggtggctgcattgcctaccc |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45066320 |
atgcaaaatgtgtaatatattcaggaagaagcttcagattgtagattatgccggcaacatgactttgagaataacattagggtggctgcattgcctaccc |
45066221 |
T |
 |
| Q |
218 |
aaacagttacttcaagtttagctccatagtagcatttttctaacttgtcatttcatatttggaccatgaatttattaggtatgctgatcgcttaaatggc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45066220 |
aaacagttacttcaagtttagctccatagtagcatttttctaacttgtcatttcatatttggaccatgaatttattaggtatgctgatcgcttaaatggc |
45066121 |
T |
 |
| Q |
318 |
tactggacggggtattttacaagcaggccagccctcacaggtt |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45066120 |
tactggacggggtattttacaagcaggccagccctcaaaggtt |
45066078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University