View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3949_high_21 (Length: 313)
Name: NF3949_high_21
Description: NF3949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3949_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 300
Target Start/End: Original strand, 15217441 - 15217740
Alignment:
| Q |
1 |
ttgtgtatttatcactttcttcaattcagtcggtgagtgagaattcaaaatctctctgatatgctttacatttaatttggttttcgtgtgtctggatgat |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15217441 |
ttgtgtatttatcactttcttcagttcagtcggtgagtgagaattcaaaatctctctaatatgctttacatttgatttggttttcgtgtgtctggatgat |
15217540 |
T |
|
| Q |
101 |
ttggaaactaaggaagaatatgattttcaacaataatgcaagaatcgttgcaacaactattggatataattaagctcgtctctttttggtcattgaaggc |
200 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15217541 |
ttgaaaactaaggaagaatatgatttttaacaataatgcaagaatcgttgcaacaactattggatataattaagctcgtctctttttggtcattgaaggc |
15217640 |
T |
|
| Q |
201 |
aaaactcgctacttttgcttttgattattgcaaataatggattatcaataattaattaccttaagtggcaaactaattaaacctctgattagtctttcct |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15217641 |
aaaactggctacttttgcttttgattattgcaaataatggattatcaataattaattaccttaagtggcaaactaattaaacctctgattagtctttcct |
15217740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 151 - 203
Target Start/End: Complemental strand, 34692424 - 34692372
Alignment:
| Q |
151 |
caacaactattggatataattaagctcgtctctttttggtcattgaaggcaaa |
203 |
Q |
| |
|
|||||||| ||||||| |||||||||| |||||||||||| |||||||||| |
|
|
| T |
34692424 |
caacaactcttggataaaattaagctcctctctttttggtgggtgaaggcaaa |
34692372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University