View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3949_high_24 (Length: 304)
Name: NF3949_high_24
Description: NF3949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3949_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 19 - 296
Target Start/End: Original strand, 51310635 - 51310912
Alignment:
| Q |
19 |
gggaagctatggtggttaaggagttgctttcgtgtaatgtgcttttcgatgaggtgatggtgtgggattctaaagaggtgaaattggatttgcatggatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310635 |
gggaagctatggtggttaaggagttgctttcgtgtaatgtgcttttcgatgaggtgatggtgtgggattctaaagaggtgaaattggatttgcatggatt |
51310734 |
T |
 |
| Q |
119 |
tcacttgggttcggcttatttggttatgttactttggttggaggagatgcagaagaggttgttgaatgcttcaaatcatgatattcctgctgaaatcact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310735 |
tcacttgggttcggcttatttggttatgttgctttggttggaggagatgcagaagaggttgttgaatgcttcaaatcatgatattcctgctgaaatcact |
51310834 |
T |
 |
| Q |
219 |
gtggtttgtggggttggaaagcatagcaatgtgagaggagaatcaccggtcaaagtattggttaaagagatgatgatg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310835 |
gtggtttgtggggttggaaagcatagcaatgtgagaggagaatcaccggtcaaagtattggttaaagagatgatgatg |
51310912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University