View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3949_high_26 (Length: 285)
Name: NF3949_high_26
Description: NF3949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3949_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 161 - 271
Target Start/End: Complemental strand, 4338766 - 4338656
Alignment:
| Q |
161 |
cactctaactctaatattctttctggataaattttatgcattgtcccgccactttggaaatggatctcatataatgcgttgaacccttcatgaaattcat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4338766 |
cactctaactctaatattctttctggataaattttatgcattgtcccgccactttggaaatggatctcatataatgcgttgaacccttcatgaaattcat |
4338667 |
T |
 |
| Q |
261 |
ccaatgaagtg |
271 |
Q |
| |
|
||||||||||| |
|
|
| T |
4338666 |
ccaatgaagtg |
4338656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University