View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3949_high_40 (Length: 237)

Name: NF3949_high_40
Description: NF3949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3949_high_40
NF3949_high_40
[»] chr2 (1 HSPs)
chr2 (1-221)||(39995771-39995989)


Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 39995989 - 39995771
Alignment:
1 tgtacggtcatgatagttgctgtttgatttctgaatatcttcaagccctagacgatgagatattgcaactaacaccataaccaataccaagcacataacc 100  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39995989 tgtacggtcatgacagttgctgtttgatttctgaatatcttcaagccctagacgatgagatattgcaactaacaccataaccaataccaagcacataacc 39995890  T
101 atggcataccaatggtgacttaatcttctaaggaattcctgcaacattaccannnnnnnnnnnnnnnnnnatgtgtgtttgaaaatgagcaagtgccaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||                  ||||||||||||||||||||||||||||||    
39995889 atggcataccaatggtgacttaatcttctaaggaattcctgcaacattacca--tctctctctattctctatgtgtgtttgaaaatgagcaagtgccaaa 39995792  T
201 gaaataatgatatttaaagag 221  Q
     |||||||||| |||||||||    
39995791 taaataatgatctttaaagag 39995771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University