View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3949_high_9 (Length: 422)
Name: NF3949_high_9
Description: NF3949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3949_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 2e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 256 - 413
Target Start/End: Complemental strand, 10356482 - 10356326
Alignment:
| Q |
256 |
catatctcaaattcataaaaaagaagaagcatcttttgaagcttagggttggaaacttttatgcggcaatgacaacataatgaagcgggagccagtaagg |
355 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10356482 |
catatctcaaatttgtaaacaa-aagaagcatcttttgaagcttagggttggaaacttttatgcggcaacgacaacataatgaaacgggagccagtaagg |
10356384 |
T |
|
| Q |
356 |
agtgatagttgactggtggtaatatgtatgtgtcctgttttggtgtctatgtctgtgc |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
10356383 |
agtgatagttgactggtggtaatatgtatgtgtcctgttttggtgtttgtgtctgtgc |
10356326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 333 - 413
Target Start/End: Original strand, 22008107 - 22008187
Alignment:
| Q |
333 |
taatgaagcgggagccagtaaggagtgatagttgactggtggtaatatgtatgtgtcctgttttggtgtctatgtctgtgc |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22008107 |
taatgaagcgggagccagtaaggagtgatagttgactggtggtaatatgtatgtgtcctgttttggtgtctgtgtctgtgc |
22008187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University