View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3949_low_13 (Length: 396)
Name: NF3949_low_13
Description: NF3949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3949_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 142 - 377
Target Start/End: Complemental strand, 49244667 - 49244437
Alignment:
| Q |
142 |
ttaacattggggtggagagtagggacagtggtagtgaggtgagtgaacatttgcttcaatttgttccttctttcacgttcaacatttagaacctcttcgg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49244667 |
ttaacattggggtggagagtagggacagtggtagtgaggtgagtgaacatttgcttcaatttgttccttctttcacgttcaacatttagaacctcttcgg |
49244568 |
T |
 |
| Q |
242 |
ttttaatagtagtggcacgttttctgttactcatttcagaaagtgatttgttactgtactcttccatacgatacgagtctcacttttagttggtttatat |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
49244567 |
ttttaatagtagtggcacgttttctgttactcatttcagaaagtgatttgttactgtactcttccat-----acgagtctcactcttagttggtttatat |
49244473 |
T |
 |
| Q |
342 |
atgaaagaaagagagagaaaattgttagtgaggttt |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
49244472 |
atgaaagaaagagagagaaaattgttagtgaggttt |
49244437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 42 - 79
Target Start/End: Complemental strand, 49244775 - 49244738
Alignment:
| Q |
42 |
cccatttcagataacaaatcaagctataatgggtcgat |
79 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49244775 |
cccatttcagataacaaatcaaactataatgggtcgat |
49244738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University