View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3949_low_15 (Length: 386)
Name: NF3949_low_15
Description: NF3949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3949_low_15 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 374; Significance: 0; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 1 - 386
Target Start/End: Complemental strand, 52048264 - 52047879
Alignment:
| Q |
1 |
tatagggatacatgatatctgatacctttttattatttcgtaacagggctatcaattttggacaattaccgatgataaaggctatttctcaataattaat |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52048264 |
tatagggacacatgatatctgatacctttttattatttcgtaacagggctatcaattttggaccattaccgatgataaaggctatttctcaataattaat |
52048165 |
T |
|
| Q |
101 |
gtacttcctggtgactataatttgtattcgtgggtcaatggattcatcggtgattatcaatgtaacaatatcattaacataacctcgggtaatgatttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52048164 |
gtacttcctggtgactataatttgtattcgtgggtcaatggattcatcggtgattatcaatgtaacaatatcattaacataacctcgggtaatgatttat |
52048065 |
T |
|
| Q |
201 |
gaagtttttcctaagttccaaatgatactagacctagtactactgctattctaaactcaatactcatttggcaaatgtgtgacataggttctgaaattaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52048064 |
gaagtttttcctaagttccaaatgatactagacctagtactactgctattctaaactcaatactcatttggcaaatgtgtgacataggttctgaaattaa |
52047965 |
T |
|
| Q |
301 |
tgtgggtgagcttgtttatgagccaccaagagatggccctacactgtgggaaataggcatccctgatcgctcagctgctgagttct |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52047964 |
tgtgggtgagcttgtttatgagccaccaagacatggccctacactgtgggaaataggcatccctgatcgctcagctgctgagttct |
52047879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 305 - 386
Target Start/End: Complemental strand, 52062768 - 52062687
Alignment:
| Q |
305 |
ggtgagcttgtttatgagccaccaagagatggccctacactgtgggaaataggcatccctgatcgctcagctgctgagttct |
386 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52062768 |
ggtgatcttgtttatgagccaccaagagatggcccaacattgtgggaaataggcatccccgatcgctcagctgctgagttct |
52062687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 367
Target Start/End: Complemental strand, 52069459 - 52069397
Alignment:
| Q |
305 |
ggtgagcttgtttatgagccaccaagagatggccctacactgtgggaaataggcatccctgat |
367 |
Q |
| |
|
||||| ||||| ||||| || ||||| |||||||| ||| |||||||||||||||| |||||| |
|
|
| T |
52069459 |
ggtgaacttgtatatgaacctccaagggatggccccacattgtgggaaataggcattcctgat |
52069397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University