View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3949_low_36 (Length: 246)
Name: NF3949_low_36
Description: NF3949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3949_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 38235794 - 38236022
Alignment:
| Q |
1 |
cggcgtgactccggcacgggtgtttgccggcgttcaaggtcgccgtcgtgccacaggacggctggcagcagcaatggtcggagtgagctcaggcagacgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38235794 |
cggcgtgactccggcacgggtgtttgccggcgttcaaggtcgccgtcgtgccacaggacggctggcagcagcaatggtcggagtgagctcaggcagacgg |
38235893 |
T |
 |
| Q |
101 |
aaaaggacggtcggcggtttccgccgacggaggtggtcggggacacaaacgacggcgtttcagtggaggagtcatttacgaatccgcatgtttctttgga |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38235894 |
aaaaggacggccggcggtttccgccgacggaggtggtcggggacacaaacgacggcgtttcagtggaggagtcatttacgaatccgcatgtttctttgga |
38235993 |
T |
 |
| Q |
201 |
gtgttttatttttctgtagattttggaag |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38235994 |
gtgttttatttttctgtagattttggaag |
38236022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 73 - 159
Target Start/End: Original strand, 38644125 - 38644211
Alignment:
| Q |
73 |
aatggtcggagtgagctcaggcagacggaaaaggacggtcggcggtttccgccgacggaggtggtcggggacacaaacgacggcgtt |
159 |
Q |
| |
|
||||||||||||||||| ||| ||||| ||| |||||||||| ||||||| ||| ||||||| || ||||||||||||||||||||| |
|
|
| T |
38644125 |
aatggtcggagtgagcttaggtagacgaaaagggacggtcggtggtttccaccgccggaggttgttggggacacaaacgacggcgtt |
38644211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 220
Target Start/End: Original strand, 16216248 - 16216288
Alignment:
| Q |
180 |
gaatccgcatgtttctttggagtgttttatttttctgtaga |
220 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
16216248 |
gaatcctcatgtttcaatggagtgttttatttttctgtaga |
16216288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University