View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3949_low_38 (Length: 240)

Name: NF3949_low_38
Description: NF3949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3949_low_38
NF3949_low_38
[»] chr3 (1 HSPs)
chr3 (1-231)||(51892882-51893112)


Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 51892882 - 51893112
Alignment:
1 caggttttgaggttggtgccgccgccgcttttatgggtggtggtggaaatgaattctgcttctatggaaactgctgaattgttgaggaaaacgggtgtga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51892882 caggttttgaggttggtgccgccgccgcttttatgggtggtggtggaaatgaattctgcttctatggaaactgctgaattgttgaggaaaacgggtgtga 51892981  T
101 tgtataggcatttggtgtgtactaagaattcaacggatgtgaaggatagaggagttcatcagagaaataaagcgttggagcatattgaacatcataaact 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51892982 tgtataggcatttggtgtgtactaagaattcaacggatgtgaaggatagaggagttcatcagagaaataaagcgttggagcatattgaacatcataaact 51893081  T
201 tgatgggattgtttactttgctgatgatgat 231  Q
    |||||||||||||||||||||||||||||||    
51893082 tgatgggattgtttactttgctgatgatgat 51893112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University