View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3949_low_42 (Length: 237)
Name: NF3949_low_42
Description: NF3949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3949_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 39995989 - 39995771
Alignment:
| Q |
1 |
tgtacggtcatgatagttgctgtttgatttctgaatatcttcaagccctagacgatgagatattgcaactaacaccataaccaataccaagcacataacc |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39995989 |
tgtacggtcatgacagttgctgtttgatttctgaatatcttcaagccctagacgatgagatattgcaactaacaccataaccaataccaagcacataacc |
39995890 |
T |
 |
| Q |
101 |
atggcataccaatggtgacttaatcttctaaggaattcctgcaacattaccannnnnnnnnnnnnnnnnnatgtgtgtttgaaaatgagcaagtgccaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39995889 |
atggcataccaatggtgacttaatcttctaaggaattcctgcaacattacca--tctctctctattctctatgtgtgtttgaaaatgagcaagtgccaaa |
39995792 |
T |
 |
| Q |
201 |
gaaataatgatatttaaagag |
221 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
39995791 |
taaataatgatctttaaagag |
39995771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University