View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3949_low_46 (Length: 233)
Name: NF3949_low_46
Description: NF3949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3949_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 66 - 217
Target Start/End: Complemental strand, 47051507 - 47051356
Alignment:
| Q |
66 |
caggtcaaaacttccatacaaattactcaaccattcaaatgtcttaaacagctaaacctcgtccttttcgcggattcgtttatatatgacatgggctatg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47051507 |
caggtcaaaacttccatacaaattactcaaccattcaaatgtcttaaacagctaaacctcgtccttttcgcggattcgtttatatatgacatgggctatg |
47051408 |
T |
 |
| Q |
166 |
gtcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47051407 |
gtcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaact |
47051356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 217
Target Start/End: Original strand, 47929058 - 47929109
Alignment:
| Q |
166 |
gtcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaact |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
47929058 |
gtcttttgtggattttaaacatccttcaagcttctcctcttctgcagaaact |
47929109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 217
Target Start/End: Complemental strand, 48453503 - 48453453
Alignment:
| Q |
167 |
tcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaact |
217 |
Q |
| |
|
|||||| |||||||||||||| || |||| ||||||||||||||||||||| |
|
|
| T |
48453503 |
tcttttctggattttaaacatcctacaagtttctcctcttttgcagaaact |
48453453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 48571222 - 48571177
Alignment:
| Q |
170 |
tttgtggattttaaacatgcttcaagcttctcctcttttgcagaaa |
215 |
Q |
| |
|
||||||||| |||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
48571222 |
tttgtggatcttaaacatccttaaagcttctcctattttgcagaaa |
48571177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 66 - 115
Target Start/End: Complemental strand, 48571304 - 48571255
Alignment:
| Q |
66 |
caggtcaaaacttccatacaaattactcaaccattcaaatgtcttaaaca |
115 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
48571304 |
caggtcacaacttctctacaaattactcaaccattcaaacatcttaaaca |
48571255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University