View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3950_low_6 (Length: 286)
Name: NF3950_low_6
Description: NF3950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3950_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 20 - 270
Target Start/End: Original strand, 9500531 - 9500781
Alignment:
| Q |
20 |
agaaggctcctcatttctatttgggattgacaactatgattattgctctctgcttgggtggagattaaaccaatctccacccttcagctaaagtgaaact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9500531 |
agaaggctcctcatttctatttgggattgacaactatgattattgctctctgcttgggtggagattaaaccaatctccacccttcagctaaagtgaaact |
9500630 |
T |
|
| Q |
120 |
tgactaggttctagggtgtatggaagaccatagttgaattttctgttctccaacctatttgctacattgataaatactgtgtttggatgtatcactggct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
9500631 |
tgactaggttctagggtgtatggaagaccatagttgaattttctgttctccaacctatttgctacaatgataaatactatgtttggaagtatcactggct |
9500730 |
T |
|
| Q |
220 |
tgtcaattttattgcttgacaattaaaatatgattctacttcccacaggtt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9500731 |
tgtcaattttattgcttgacaattaaaatatgattctacttcccataggtt |
9500781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University